Homing endonuclease gene



Keywords: homing endonuclease gene
Description: Homing endonuclease genes (HEGs) are ‘selfish’ genetic elements that combine the capability to selectively disrupt specific gene sequences with the ability to rapidly spread from a

Homing endonuclease genes (HEGs) are ‘selfish’ genetic elements that combine the capability to selectively disrupt specific gene sequences with the ability to rapidly spread from a few individuals to an entire population through homologous recombination repair events. Because of these properties, HEGs are regarded as promising candidates to transfer genetic modifications from engineered laboratory mosquitoes to wild-type populations including Anopheles gambiae the vector of human malaria. Here we show that I-SceI and I-PpoI homing endonucleases cleave their recognition sites with high efficiency in A. gambiae cells and embryos and we demonstrate HEG-induced homologous and non-homologous repair events in a variety of functional assays. We also propose a gene drive system for mosquitoes that is based on our finding that I-PpoI cuts genomic rDNA located on the X chromosome in A. gambiae. which could be used to selectively incapacitate X-carrying spermatozoa thereby imposing a severe male-biased sex ratio.

Mosquito species of the Anopheles gambiae complex represent the major vectors of human malaria and they pose an enormous burden on global health and economies. Every year 300–500 million people are infected by malaria and over a million people die as consequence of Plasmodium parasite infections (1 ). While many insect pests have long been successful targeted with population control measures such as insecticides or release of sterile males (2 ), for others, including A. gambiae. classical control measures have largely failed to deliver long-term solutions. Disease endemic countries often do not have the economic resources and the logistics to sustain control efforts like the massive and prolonged use of insecticides. New control strategies that are affordable, easy to implement and sustainable are desperately needed.

This global health problem has prompted an unprecedented effort aimed at generating new molecular tools and a better understanding of the biology and the genetics of Anopheline mosquitoes that culminated in the sequencing of the A. gambiae genome (3 ) and development of gene transfer technology for a series of vectors species (4 ,5 ). These molecular advances have made it possible to express genes that can block the transmission of Plasmodium in model systems (6–8 ) or express traits facilitating the implementation of sterile insect techniques for vector control (9 ).

The translation of these achievements in suitable control measures still represents a major scientific and technical challenge. Genetically modified mosquitoes carrying a desired trait such as malaria refractoriness would need to be released on a gigantic scale given the vast numbers of these insects and the wide areas that are inhabited by vectors of human tropical diseases. Therefore, a mechanism must be developed to spread the desired genetic modification from a few laboratory-reared mosquitoes to a large fraction of the wild-type vector population (10 ,11 ). Naturally occurring ‘selfish’ genetic elements that have non-mendelian inheritance mechanisms and spread through populations even when they provide no benefit to the host organism (12 ) have been proposed to transform wild-type mosquito populations.

Homing endonuclease genes (HEGs) are highly specific DNA endonucleases found in some viruses, bacteria and eukaryotes. The endonuclease promotes the movement of its encoding DNA from one allele to the other by creating a double-strand break (DSB) at a specific, long (15–40 bp) target site in an allele that lacks the HEG. Homologous DNA repair then copies the HEG to the cut chromosome in a process called ‘gene conversion’ (13 ,14 ).

The observation that HEGs can be engineered to cleave novel DNA sequences (15–18 ) offers a multitude of opportunities to utilize these elements for mosquito control. For example, HEGs could be used to disrupt genes regulating the ability of Anopheles mosquitoes to function as efficient vectors for Plasmodium parasites, or to drive recombinant refractory genes through a mosquito population, rendering them unable to transmit malaria. Alternatively, HEGs designed to target an essential mosquito gene or a gene required for female fertility could be utilized to introduce a genetic load on the population leading to population size reduction or collapse (19 ). More recently, it has been suggested that a harmful selfish element put under the control of a promoter which is active in individuals susceptible to Plasmodium infection but inactive in refractory individuals should drive alleles causing refractoriness through the population (20 ). Finally, HEGs could be used to bias the sex ratio towards males, using an endonuclease that targets X-linked sequences and is expressed during male spermatogenesis from the Y chromosome (19 ).

To investigate the feasibility of using HEGs as driving genetic element in mosquitoes, we have analysed the activity of ectopic HEGs in both A. gambiae cells and embryos, using experimental systems that are highly predictive of in vivo behaviour of mobile genetic elements (21 ,22 ). We determined the activity of two well-characterized HEGs, I-PpoI (a member of the His-Cys box family of endonucleases from the slime mold Physarum polycephalum ) (23–25 ) and I-SceI (a LAGLIDADG class endonuclease originally isolated from Saccharomyces cerevisiae mitochondria) (26–28 ), both of which have been used in a variety of organisms (including Drosophila ) to induce DNA DSBs (29–32 ). We systematically analysed the nature of HEG-mediated integration and recombination events in A. gambiae and the effect of expressing these endonucleases on cell proliferation.

The target plasmids pBC/SacRB S1/S2/S3 and pBC/SacRB P1 were constructed as follows: pBC/SacRB (21 ) was cut with SalI and PstI, ends filled in with T4 DNA polymerase and religated to remove a redundant EcoRI site. Linkers were created by annealing 5′ phosphorylated oligonucleotides (S1: AATTCATTACCCTGTTATCCTAG and AATTCTAGGGATAACAGGGTAATG; S2: AATTCGATAGGGATAACAGGGTAATTG and AATTCAATTACCCTGTTATCCCTATCG; S3: AATTCAATTACCCTGTTATCCCTACCG and AATTCGGTAGGGATAACAGGGTAATTG; P1: AATTCCGCTACCTTAAGAGAGTCG and AATTCGACTCTCTTAAGGTAGCGG), which were cloned into the now unique EcoRI site in the SacRB CDS. Selection against SacRB was performed in LB agar lacking NaCl containing 15% sucrose (w/v) and chloramphenicol (25 μg/ml).

To create pSL-SacRB Tet. the minimal 1.5 kb tetracycline (Tet) resistance cassette from pBR322 was amplified with the primers TTCAAGAATTCTCATGTTTGACAG and ATGAATTCTGCTAACCAGTAAGGCAACC and cloned into pBC/SacRB with EcoRI. The Tet cassette replaces the I-SceI site and disrupts the SacRB gene. The 3.4 kb SacRB Tet cassette was moved to pSLfa1180fa (33 ) using XhoI/XbaI to create pSL-SacRB Tet .

To create pDR-CMV-GFP, the CMV promoter from pEGFP-Ppo was amplified with the primers AAAGGGCCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAG and AAAGAATTCGATCTGACGGTTCACTAAACCAGCTC and cut with ApaI and EcoRI. The fragment was ligated into partially ApaI and EcorI digested pDR-GFP (34 ). This replaces the 3′ part of the chicken β-actin promoter with CMV. To remove the remaining sequences of the chicken β-actin promoter, the resulting vector was cut with SnaBI and religated.

PSL-Act-EGFP was constructed in pSLFa1180fa to contain the 2.5 kb Drosophila Actin 5C promoter driving EGFP (BamHI/XbaI fragment) and the Drosophila Hsp70 terminator.

Cells from the stable anchorage-dependent A. gambiae cell line, Suakoko 4 (Sua 4.0) (Müller,H.M. et al.. 1999) were cultured in Schneider's Drosophila medium (Invitrogen) supplemented with 10% FCS (Invitrogen) and 200 U/ml penicillin and 200 μg/ml streptomycin sulphate (Invitrogen) in a cooled incubator at 27°C.

In vivo HEG activity assays were performed by lipid-mediated transient transfections (Effecten, Qiagen) of 1–3 × 10 5 cells with 2 μg/ml (culture volume) recipient plasmid and 4 μg/ml donor plasmid. When necessary, cells were heat-shocked for 1 h at 41°C, 24 h post-transfection to induce expression of I-SceI from the Drosophila Hsp70 promoter on the pP[v+, 70 I-SceI] plasmid. Total DNA was extracted 48 h post-transfection (Promega Wizard Genomic DNA purification Kit) and re-suspended at 25–40 μl. This preparation was used to transform Escherichia coli DH5α strain.

Anopheles gambiae adult females (G3 strain) were allowed to deposit their embryos 72 h after a blood meal on a moist filter paper. Embryos were injected 60–120 min after oviposition, essentially as described (35 ). Embryos were injected with a mixture of I-SceI donor plasmid pP[v+, 70 I-SceI] (400 μg/ml), Tet donor plasmid pSL-SacRB Tet (500 μg/ml) and HEG target plasmid pBC/SacRB S1 (500 μg/ml). Between 150 and 200 embryos were microinjected and 12 h later embryos were heat-shocked for 1 h at 41°C and left to recover for 2 h. Low molecular weight DNA was extracted (21 ), re-suspended in 20 μl and 150 ng of the recovered DNA was used to transform E. coli DH5α strain.

Genomic DNA was digested with ClaI in the presence and absence of I-PpoI. As a probe we used a 2 kb rDNA PCR fragment amplified from genomic DNA using the primers GCCGAAGCAATTAGCCCTTAAAATGGATG and CACCAGTAGGGTAAAACTAACCTGTCTCACG. The probe was P 32 labelled using the High Prime DNA labelling kit (Roche) and purified with ProbeQuant™ G-50 columns (GE Healthcare). For primer extension, genomic DNA was digested with HincII (a.k.a. HindII). The reaction was performed essentially as described (36 ) using the 5′ P 32 -labelled primer rPrex GTTAATCCATTCATGCGCGTCACTAATTAG and vent (exo-) polymerase (New England Biolabs). The reaction products were resolved on a 6% denaturing polyacrylamide gel. Results for both experiments were visualized using a FUJIFILM-FLA-5000 Phosphoimager (Fuji Photo Film Co. Ltd, Stamford, CT, USA). For in vitro digestions, we used commercially available I-PpoI (Promega) and I-SceI (New England Biolabs) enzymes.

Sua 4.0 cells were transfected with either of the two endonuclease plasmids (4 μg/ml) together with pIB/V5-His (2 μg/ml), conferring resistance to blasticidin (Invitrogen). Forty-eight hours post-transfection, blasticidin was supplemented to complete medium at 50 μg/ml. Cells were incubated in blasticidin for an initial proliferation period of 5 days, at which point they were harvested and re-seeded at 1.5 × 10 5 cells/ml and grown for a further 5 days. Transfections were performed in triplicates and cell numbers for each were counted in four replicates.

Anopheles gambiae Sua 4.0 cells were transfected with pEGFP-Ppo, pEGFP-Ppo H98A and the control pSL-Act-GFP, and 48 h later cells were fixed for 5 min in 4% paraformaldehyde and permiabilized for 10 min with 0.1% Triton X-100. Nuclei were stained with DAPI (2 ng/μl) and actin filaments with Alexa546-phalloidin (1 U/ml, Invitrogen). Cell micrographs were taken at ×40 magnification using a Zeiss widefield microscope.

I-SceI and I-PpoI expression constructs and their activity in A. gambiae cells. (a ) Maps of HEG expression and target vectors used in the interplasmid activity assay. CMV, cytomegalovirus promoter; Hsp70, Drosophila heatshock protein 70 promoter; eGFP .

The I-SceI or I-PpoI recognition sites were inserted in the SacRB sequence after Glu67, downstream of the signal peptide required for secretion (39 ), at a position predicted not to be essential (40 ). We assessed the effect of inserting several recognition site variants in different frames on SacRB activity. None of the inserted amino acid variants (pBC/SacRB S1: ITLLSL. pBC/SacRB S2: D RDNRV I, pBC/SacRB S3: N YPVIP I for I-SceI; pBC/SacRB P1: ATLRE for I-PpoI) interfered with SacRB function as inferred by the continued inability of bacteria transformed with these vectors to grow on Cam supplemented with 15% sucrose (data not shown). We therefore concluded that the SacRB gene is tolerant to amino acid insertions at this position and a variety of recognition sequences of natural and reengineered HEGs could be inserted and tested using this approach.

We transfected the plasmids pP[v+,70I-SceI] and pEGFP-Ppo together with their corresponding target pBC/SacRB S1 and pBC/SacRB P1 into A. gambiae Sua4.0 cell lines ( Figure 1 a). The plasmid pP[v+,70I-SceI] (30 ) expresses the I-SceI ORF with an N-terminal SV40 NLS and hemagglutinin (HA) tag under the control of the Drosophila Hsp70 promoter, which directs a significant inducible expression of I-SceI in Sua4.0 cells ( Figure 1 d, lanes 2 and 3). The plasmid pEGFP-Ppo expresses the EGFP-I-PpoI fusion protein containing a SV40 NLS ( Figure 1 a and d) under the control of the CMV promoter. An inactive variant pEGFP-Ppo H98A (Raymond Monnat personal communication) was used as a control. Cells were heat-shocked for 1 h at 41°C 24 h post transfection and DNA extracted after an additional 24 h. Under these experimental conditions, we observed that the target plasmids were cut in vivo by the corresponding endonuclease ( Figure 1 b). Digestion of DNA extracted from transfected cells with purified endonucleases in vitro revealed the presence of a fraction of endonuclease resistant plasmids ( Figure 1 b, lanes 6–10, white arrow), possibly generated by non-homologous religation of HEG-mediated cleavage events.

To recover and analyse non-homologous end joining (NHEJ) events generated in mosquito cells, total DNA (which includes plasmid DNA) extracted from transfected cells was used to transform bacterial cells plated on Cam or Cam/Suc selective media. Compared to control experiments (target plasmid only), transfection of mosquito cells with I-SceI- or I-PpoI expressing plasmids increases the number of Cam/Suc resistant clones by 15- and 8-fold, respectively ( Figure 1 c). By comparing the colony numbers on Cam and Cam/Suc plates of bacteria transformed with recovered DNA from A. gambiae cells, we found that ∼0.5–2% of recovered plasmids allowed growth on Cam/Suc as compared to Cam alone. This indicates that although HEG cleavage is efficient ( Figure 1 b) only a small number of these plasmids are subsequently religated.

Plasmids from Cam/Suc-resistant bacterial cells were isolated and digested with BamHI and HindIII endonucleases. Only plasmids showing a 1.8 kb band, indicating the presence of an intact SacRB gene ( Figure 1 a), were analysed by sequencing ( Figure 2 ). This step was undertaken to ensure that sucrose resistance is due to HEG-mediated disruption of SacRB, as we occasionally observed the growth of Cam/Suc-resistant bacteria in the absence of a HEG expression vector ( Figure 1 c). Digestion of plasmids with BamHI/HindIII in the presence of I-SceI or I-PpoI showed that all recovered clones were also resistant to endonuclease cleavage in vitro (data not shown). The sequence of the regions surrounding the HEG cleavage sites was analysed in plasmids recovered from Cam/Suc-resistant bacteria ( Figure 2 ). All 27 sequenced clones showed deletion events of variable sizes, ranging from 1 to 80 bp, close to the predicted HEG cleavage site. We did not observe any nucleotide insertions, contrary to reports of NHEJ repair products in human cell lines (41 ,42 ).

DNA sequence analysis of clones created by HEG cleavage and non-homologous repair. (a ) Clones of pBC/SacRB P1 isolated from Sua4.0 cells after co-transfection with I-PpoI expression vector pEGFP-Ppo. (b ) Clones of pBC/SacRB S1 isolated from Sua4.0 cells .






Photogallery Homing endonuclease gene:


Powerful Genetic Engineering Technique Could Modify Entire Wild ...


A synthetic homing endonuclease-based gene drive system in the ...


Group I introns and associated homing endonuclease genes reveals a ...


Figure 2 : Emerging biomedical applications of synthetic biology ...


Home and away- the evolutionary dynamics of homing endonucleases ...


The Plant Genome - Article | Digital Library


Restriction Endonucleases: Molecular Cloning and Beyond | NEB


Germline excision of transgenes in Aedes aegypti by homing ...


Emerging biomedical applications of synthetic biology : Article ...


Evolutionary Dynamics of the mS952 Intron: A Novel Mitochondrial ...


tmp1C139_thumb1.jpg


www.mobilednajournal.com - Figure


Novel Group I Introns Encoding a Putative Homing Endonuclease in ...


Homing Endonuclease Design


Frontiers | Post-zygotic sterility and cytonuclear compatibility ...


F2.large.jpg


Frontiers | Endonuclease domain of the Drosophila melanogaster R2 ...


Frontiers | Emerging gene editing strategies for Duchenne muscular ...


www.biomedcentral.com - Figure